Skip to contents

dada2 workflow to generate ASV table

Usage

dada2_asvtable(
  where = NULL,
  example = FALSE,
  patternF = "_R1_001.fastq.gz",
  patternR = "_R2_001.fastq.gz",
  multi = FALSE,
  chatty = TRUE,
  logfile = TRUE,
  ...
)

Arguments

where

Path to your fastq files.

example

Set to TRUE to run example

patternF

Pattern of the forward/R1 reads. Default is Illumina standard.

patternR

Pattern of the reverse/R2 reads. Default is Illumina standard

multi

Should multithreading be done? Can use this to set to TRUE or FALSE for entire wrapper.

chatty

How chatty should code be? Default is TRUE, but set to FALSE if you don't want so much text going to the console.

logfile

Write a logfile to user's computer. Default is TRUE

...

Allows passing of arguments to nested functions

Value

dada2 ASV table

Examples

dada2_asvtable(example = TRUE)
#> [1] "Because you're running the example, any output files will go to a temporary directory, /tmp/RtmpCCzUxF/dada2_out. To avoid cluttering your computer, this folder and its contents should all be deleted at the end of your R session."
#> [1] "Because you're running the example, any output files will go to a temporary directory, /tmp/RtmpCCzUxF/dada2_out. To avoid cluttering your computer, this folder and its contents should all be deleted at the end of your R session."
#> Overwriting file:/tmp/RtmpCCzUxF/dada2_out/filtered/SAMPLED_5080-MS-1_307-ATAGTACC-ACGTCTCG_S307_L001_F_filt.fastq.gz
#> Overwriting file:/tmp/RtmpCCzUxF/dada2_out/filtered/SAMPLED_5080-MS-1_307-ATAGTACC-ACGTCTCG_S307_L001_R_filt.fastq.gz
#> Read in 50 paired-sequences, output 11 (22%) filtered paired-sequences.
#> Overwriting file:/tmp/RtmpCCzUxF/dada2_out/filtered/SAMPLED_5080-MS-1_313-GACATAGT-TCGACGAG_S313_L001_F_filt.fastq.gz
#> Overwriting file:/tmp/RtmpCCzUxF/dada2_out/filtered/SAMPLED_5080-MS-1_313-GACATAGT-TCGACGAG_S313_L001_R_filt.fastq.gz
#> Read in 50 paired-sequences, output 26 (52%) filtered paired-sequences.
#> Overwriting file:/tmp/RtmpCCzUxF/dada2_out/filtered/SAMPLED_5080-MS-1_328-GATCTACG-TCGACGAG_S328_L001_F_filt.fastq.gz
#> Overwriting file:/tmp/RtmpCCzUxF/dada2_out/filtered/SAMPLED_5080-MS-1_328-GATCTACG-TCGACGAG_S328_L001_R_filt.fastq.gz
#> Read in 50 paired-sequences, output 46 (92%) filtered paired-sequences.
#> Overwriting file:/tmp/RtmpCCzUxF/dada2_out/filtered/SAMPLED_5080-MS-1_339-ACTCACTG-GATCGTGT_S339_L001_F_filt.fastq.gz
#> Overwriting file:/tmp/RtmpCCzUxF/dada2_out/filtered/SAMPLED_5080-MS-1_339-ACTCACTG-GATCGTGT_S339_L001_R_filt.fastq.gz
#> Read in 50 paired-sequences, output 41 (82%) filtered paired-sequences.
#> Overwriting file:/tmp/RtmpCCzUxF/dada2_out/filtered/SAMPLED_5348-MS-1_162-ACGTGCGC-GGATATCT_S162_L001_F_filt.fastq.gz
#> Overwriting file:/tmp/RtmpCCzUxF/dada2_out/filtered/SAMPLED_5348-MS-1_162-ACGTGCGC-GGATATCT_S162_L001_R_filt.fastq.gz
#> Read in 50 paired-sequences, output 37 (74%) filtered paired-sequences.
#> Overwriting file:/tmp/RtmpCCzUxF/dada2_out/filtered/SAMPLED_5348-MS-1_297-GTCTGCTA-ACGTCTCG_S297_L001_F_filt.fastq.gz
#> Overwriting file:/tmp/RtmpCCzUxF/dada2_out/filtered/SAMPLED_5348-MS-1_297-GTCTGCTA-ACGTCTCG_S297_L001_R_filt.fastq.gz
#> Read in 50 paired-sequences, output 44 (88%) filtered paired-sequences.
#> Overwriting file:/tmp/RtmpCCzUxF/dada2_out/filtered/SAMPLED_5348-MS-1_381-TGCTCGTA-GTCAGATA_S381_L001_F_filt.fastq.gz
#> Overwriting file:/tmp/RtmpCCzUxF/dada2_out/filtered/SAMPLED_5348-MS-1_381-TGCTCGTA-GTCAGATA_S381_L001_R_filt.fastq.gz
#> Read in 50 paired-sequences, output 43 (86%) filtered paired-sequences.
#> 59520 total bases in 248 reads from 7 samples will be used for learning the error rates.
#> Initializing error rates to maximum possible estimate.
#> selfConsist step 1 .......
#>    selfConsist step 2
#> Convergence after  2  rounds.
#> 49600 total bases in 248 reads from 7 samples will be used for learning the error rates.
#> Initializing error rates to maximum possible estimate.
#> selfConsist step 1 .......
#>    selfConsist step 2
#> Convergence after  2  rounds.
#> Dereplicating sequence entries in Fastq file: /tmp/RtmpCCzUxF/dada2_out/filtered/SAMPLED_5080-MS-1_307-ATAGTACC-ACGTCTCG_S307_L001_F_filt.fastq.gz
#> Encountered 11 unique sequences from 11 total sequences read.
#> Dereplicating sequence entries in Fastq file: /tmp/RtmpCCzUxF/dada2_out/filtered/SAMPLED_5080-MS-1_313-GACATAGT-TCGACGAG_S313_L001_F_filt.fastq.gz
#> Encountered 25 unique sequences from 26 total sequences read.
#> Dereplicating sequence entries in Fastq file: /tmp/RtmpCCzUxF/dada2_out/filtered/SAMPLED_5080-MS-1_328-GATCTACG-TCGACGAG_S328_L001_F_filt.fastq.gz
#> Encountered 37 unique sequences from 46 total sequences read.
#> Dereplicating sequence entries in Fastq file: /tmp/RtmpCCzUxF/dada2_out/filtered/SAMPLED_5080-MS-1_339-ACTCACTG-GATCGTGT_S339_L001_F_filt.fastq.gz
#> Encountered 36 unique sequences from 41 total sequences read.
#> Dereplicating sequence entries in Fastq file: /tmp/RtmpCCzUxF/dada2_out/filtered/SAMPLED_5348-MS-1_162-ACGTGCGC-GGATATCT_S162_L001_F_filt.fastq.gz
#> Encountered 30 unique sequences from 37 total sequences read.
#> Dereplicating sequence entries in Fastq file: /tmp/RtmpCCzUxF/dada2_out/filtered/SAMPLED_5348-MS-1_297-GTCTGCTA-ACGTCTCG_S297_L001_F_filt.fastq.gz
#> Encountered 33 unique sequences from 44 total sequences read.
#> Dereplicating sequence entries in Fastq file: /tmp/RtmpCCzUxF/dada2_out/filtered/SAMPLED_5348-MS-1_381-TGCTCGTA-GTCAGATA_S381_L001_F_filt.fastq.gz
#> Encountered 36 unique sequences from 43 total sequences read.
#> Dereplicating sequence entries in Fastq file: /tmp/RtmpCCzUxF/dada2_out/filtered/SAMPLED_5080-MS-1_307-ATAGTACC-ACGTCTCG_S307_L001_R_filt.fastq.gz
#> Encountered 11 unique sequences from 11 total sequences read.
#> Dereplicating sequence entries in Fastq file: /tmp/RtmpCCzUxF/dada2_out/filtered/SAMPLED_5080-MS-1_313-GACATAGT-TCGACGAG_S313_L001_R_filt.fastq.gz
#> Encountered 23 unique sequences from 26 total sequences read.
#> Dereplicating sequence entries in Fastq file: /tmp/RtmpCCzUxF/dada2_out/filtered/SAMPLED_5080-MS-1_328-GATCTACG-TCGACGAG_S328_L001_R_filt.fastq.gz
#> Encountered 35 unique sequences from 46 total sequences read.
#> Dereplicating sequence entries in Fastq file: /tmp/RtmpCCzUxF/dada2_out/filtered/SAMPLED_5080-MS-1_339-ACTCACTG-GATCGTGT_S339_L001_R_filt.fastq.gz
#> Encountered 35 unique sequences from 41 total sequences read.
#> Dereplicating sequence entries in Fastq file: /tmp/RtmpCCzUxF/dada2_out/filtered/SAMPLED_5348-MS-1_162-ACGTGCGC-GGATATCT_S162_L001_R_filt.fastq.gz
#> Encountered 31 unique sequences from 37 total sequences read.
#> Dereplicating sequence entries in Fastq file: /tmp/RtmpCCzUxF/dada2_out/filtered/SAMPLED_5348-MS-1_297-GTCTGCTA-ACGTCTCG_S297_L001_R_filt.fastq.gz
#> Encountered 32 unique sequences from 44 total sequences read.
#> Dereplicating sequence entries in Fastq file: /tmp/RtmpCCzUxF/dada2_out/filtered/SAMPLED_5348-MS-1_381-TGCTCGTA-GTCAGATA_S381_L001_R_filt.fastq.gz
#> Encountered 37 unique sequences from 43 total sequences read.
#> Sample 1 - 11 reads in 11 unique sequences.
#> Sample 2 - 26 reads in 25 unique sequences.
#> Sample 3 - 46 reads in 37 unique sequences.
#> Sample 4 - 41 reads in 36 unique sequences.
#> Sample 5 - 37 reads in 30 unique sequences.
#> Sample 6 - 44 reads in 33 unique sequences.
#> Sample 7 - 43 reads in 36 unique sequences.
#> Sample 1 - 11 reads in 11 unique sequences.
#> Sample 2 - 26 reads in 23 unique sequences.
#> Sample 3 - 46 reads in 35 unique sequences.
#> Sample 4 - 41 reads in 35 unique sequences.
#> Sample 5 - 37 reads in 31 unique sequences.
#> Sample 6 - 44 reads in 32 unique sequences.
#> Sample 7 - 43 reads in 37 unique sequences.
#> 0 paired-reads (in 0 unique pairings) successfully merged out of 1 (in 1 pairings) input.
#> 0 paired-reads (in 0 unique pairings) successfully merged out of 10 (in 1 pairings) input.
#> 44 paired-reads (in 1 unique pairings) successfully merged out of 44 (in 1 pairings) input.
#> 37 paired-reads (in 2 unique pairings) successfully merged out of 37 (in 2 pairings) input.
#> 28 paired-reads (in 3 unique pairings) successfully merged out of 28 (in 3 pairings) input.
#> 41 paired-reads (in 2 unique pairings) successfully merged out of 41 (in 2 pairings) input.
#> 0 paired-reads (in 0 unique pairings) successfully merged out of 31 (in 3 pairings) input.
#> Identified 0 bimeras out of 6 input sequences.
#> # A tibble: 7 × 7
#>   SampleID  TACGTAGGTGGCAAGCGTTA…¹ TACGGAGGGTGCAAGCGTTA…² TACGTAGGGTGCGAGCGTTG…³
#>   <chr>                      <int>                  <int>                  <int>
#> 1 SAMPLED_…                      0                      0                      0
#> 2 SAMPLED_…                      0                      0                      0
#> 3 SAMPLED_…                     44                      0                      0
#> 4 SAMPLED_…                     24                      0                      0
#> 5 SAMPLED_…                      0                      0                     12
#> 6 SAMPLED_…                      0                     35                      6
#> 7 SAMPLED_…                      0                      0                      0
#> # ℹ abbreviated names:
#> #   ¹​TACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATGTGTAGCGGTGAAATGCGCAGAGATATGGAGGAACACCAGTGGCGAAGGCGACTTTCTGGTCTGTAACTGACGCTGATGTGCGAAAGCGTGGGGATCAAACAGG,
#> #   ²​TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACAAAGACTGACGCTCAGGTGCGAAAGCGTGGGGAGCAAACAGG,
#> #   ³​TACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGCTCGTAGGTGGTTTGTCGCGTCGTCTGTGAAATTCTGGGGCTTAACTCCGGGCGTGCAGGCGATACGGGCATAACTTGAGTGCTGTAGGGGTAACTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGATGGCGAAGGCAGGTTACTGGGCAGTTACTGACGCTGAGGAGCGAAAGCATGGGTAGCGAACAGG
#> # ℹ 3 more variables:
#> #   TACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTCACGTCGTCTGTGAAATTCCACAGCTTAACTGTGGGCGTGCAGGCGATACGGGCTGACTTGAGTACTGTAGGGGTAACTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGATGGCGAAGGCAGGTTACTGGGCAGTTACTGACGCTGAGGAGCGAAAGCATGGGTAGCAAACAGG <int>,
#> #   TACGTAGGTGACAAGCGTTGTCCGGATTTATTGGGCGTAAAGGGAGCGCAGGCGGTCTGTTTAGTCTAATGTGAAAGCCCACGGCTTAACCGTGGAACGGCATTGGAAACTGACAGACTTGAATGTAGAAGAGGAAAATGGAATTCCAAGTGTAGCGGTGGAATGCGTAGATATTTGGAGGAACACCAGTGGCGAAGGCGATTTTCTGGTCTAACATTGACGCTGAGGCTCGAAAGCGTGGGGAGCGAACAGG <int>, …