Skip to contents

Microbiome data analysis tools for R

The goal of micro4R was to create an R package with a low barrier to entry. I started my career in microbiome research at the bench and had to ELI5 to myself how to process and analyze “big data”. I’ve spent a ton of time poring over and experimenting with [others’ code]UPDATE URL, and want to pass it on. # micro4R micro4R website

Likely, the ideal candidate to benefit from micro4R would be a bench scientist without much formal statistics or bioinformatics training. Fair warning, if you already have a strong stats/informatics background, this may not be of much use for you!

This package does not create any brand new functionality and was built on the great work of [others]UPDATE URL. Much of what it does can be accomplished with other packages, such as phyloseq, QIIME 2, and MicrobiomeAnalyst. One of these may be better for your purposes, and I’d encourage anyone new to the field to explore multiple tools.

Installation

You can install the development version of micro4R like so:

# install.packages("pak")
pak::pak("mshilts1/micro4R")

Example

I’ll run through the smallest and simplest possible use case below. For more detailed help and documentation, please explore the vignettes (link(s) TBA).

Included with the package is an extremely tiny toy example to demonstrate its major functionality, using subsampled publicly available data.

The first thing we’ll do on these files is run ‘dada2_asvtable()’. This function can take a number of arguments, but the most important one is ‘where’, which is the path to where your FASTQ files are located.
For demonstration purposes, it’s been set to the relative path of the the example FASTQ files that are included with the package:

library(micro4R)

asvtable <- dada2_asvtable(where = "inst/extdata/f", chatty = FALSE)
#> Creating output directory: /var/folders/pp/15rq6p297j18gk2xt39kdmm40000gp/T//Rtmp8ajRV1/dada2_out/filtered
#> 59520 total bases in 248 reads from 7 samples will be used for learning the error rates.
#> 49600 total bases in 248 reads from 7 samples will be used for learning the error rates.
tibble::as_tibble(asvtable, rownames = "SampleID")
#> # A tibble: 7 × 7
#>   SampleID  TACGTAGGTGGCAAGCGTTA…¹ TACGGAGGGTGCAAGCGTTA…² TACGTAGGGTGCGAGCGTTG…³
#>   <chr>                      <int>                  <int>                  <int>
#> 1 SAMPLED_…                      0                      0                      0
#> 2 SAMPLED_…                      0                      0                      0
#> 3 SAMPLED_…                     44                      0                      0
#> 4 SAMPLED_…                     24                      0                      0
#> 5 SAMPLED_…                      0                      0                     12
#> 6 SAMPLED_…                      0                     35                      6
#> 7 SAMPLED_…                      0                      0                      0
#> # ℹ abbreviated names:
#> #   ¹​TACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATGTGTAGCGGTGAAATGCGCAGAGATATGGAGGAACACCAGTGGCGAAGGCGACTTTCTGGTCTGTAACTGACGCTGATGTGCGAAAGCGTGGGGATCAAACAGG,
#> #   ²​TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACAAAGACTGACGCTCAGGTGCGAAAGCGTGGGGAGCAAACAGG,
#> #   ³​TACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGCTCGTAGGTGGTTTGTCGCGTCGTCTGTGAAATTCTGGGGCTTAACTCCGGGCGTGCAGGCGATACGGGCATAACTTGAGTGCTGTAGGGGTAACTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGATGGCGAAGGCAGGTTACTGGGCAGTTACTGACGCTGAGGAGCGAAAGCATGGGTAGCGAACAGG
#> # ℹ 3 more variables:
#> #   TACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTCACGTCGTCTGTGAAATTCCACAGCTTAACTGTGGGCGTGCAGGCGATACGGGCTGACTTGAGTACTGTAGGGGTAACTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGATGGCGAAGGCAGGTTACTGGGCAGTTACTGACGCTGAGGAGCGAAAGCATGGGTAGCAAACAGG <int>,
#> #   TACGTAGGTGACAAGCGTTGTCCGGATTTATTGGGCGTAAAGGGAGCGCAGGCGGTCTGTTTAGTCTAATGTGAAAGCCCACGGCTTAACCGTGGAACGGCATTGGAAACTGACAGACTTGAATGTAGAAGAGGAAAATGGAATTCCAAGTGTAGCGGTGGAATGCGTAGATATTTGGAGGAACACCAGTGGCGAAGGCGATTTTCTGGTCTAACATTGACGCTGAGGCTCGAAAGCGTGGGGAGCGAACAGG <int>, …

If you’re running this with your own data, set ‘where’ to the path where your fastq files are stored. If you leave it empty (e.g., run dada2_asvtable(), it will default to your current working directory.) (‘chatty’ was set to FALSE because tons of information gets printed to the console otherwise; I’d recommend setting it to TRUE (the default) when you’re processing data for real, as the information is useful, but just too much here.)

Now we have a bunch of literal DNA sequences. That’s great, but what are they? The next step will take the sequences and compare them against a database or two of sequences with known taxonomy:

train <- "inst/extdata/db/EXAMPLE_silva_nr99_v138.2_toGenus_trainset.fa.gz"
species <- "inst/extdata/db/EXAMPLE_silva_v138.2_assignSpecies.fa.gz"
dada2_taxa(asvtable = asvtable, train = train, species = species, chatty = FALSE)

There are two databases that we’re using for taxonomic assignment here:
1. ‘train’ needs to be the path to whatever you’d like to use as the “training set of reference sequences with known taxonomy”.
2. ‘species’ is OPTIONAL. If you’d like to use this option, provide the path to a specifically formatted species assignment database. (Read more here.)

The two databases used in the example here are comically small and artificial, and should only ever be used for testing and demonstration purposes. You’ll definitely want/need to download the real databases for your actual data!

There are many options for taxonomic databases you can use; the major players are SILVA, RDP, GreenGenes, and UNITE. Please go here for details and links. I tend to usually use the SILVA databases, but you don’t have to.


Move information to the bottom for anyone who wants more details

subsampled FASTQ files from a manuscript I co-authored with my colleagues, for which the raw data is publicly available under bioproject ID PRJNA726992. From seven samples from this study, using seqtk, I randomly sampled only 50 reads from each FASTQ file so that the files would take up minimal space and the example would run quickly.

Skip to the next section if you don’t care. If you’d like to run through this the full fastq files can be downloaded from SRA or as a zipped bolus here

Link to dada2-ified reference databases https://benjjneb.github.io/dada2/training.html

Not going to keep this on the readme, but want to hold onto the logo code until I put it somewhere else.
s <- sticker(image_path, package=“micro4R”, p_size=15, p_family = “Comfortaa”, p_fontface = “bold”, p_y = 1.5, s_x=1, s_y=.75, s_width=.5, s_height = .5, p_color = “black”, h_fill = “#6ed5f5”, h_color= “#16bc93”, h_size = 2, filename=“inst/figures/imgfile.png”).

built R 4.5.1
RStudio Version 2025.05.1+513 (2025.05.1+513) macOS Sequoia Version 15.6.1